Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QM970_RS02155 Genome accession   NZ_CP125980
Coordinates   427984..428106 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ZKY03     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 422984..433106
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QM970_RS02140 (QM970_02155) yclJ 424598..425281 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  QM970_RS02145 (QM970_02160) yclK 425268..426689 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  QM970_RS02150 (QM970_02165) rapC 426852..428000 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  QM970_RS02155 (QM970_02170) phrC 427984..428106 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QM970_RS02160 (QM970_02175) yczM 428205..428294 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  QM970_RS02165 (QM970_02180) yczN 428376..428489 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  QM970_RS02170 (QM970_02185) thrD 428642..430006 (-) 1365 WP_264379419.1 aspartate kinase -
  QM970_RS02175 (QM970_02190) ceuB 430391..431341 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QM970_RS02180 (QM970_02195) yclO 431334..432281 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  QM970_RS02185 (QM970_02200) yclP 432275..433033 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=765488 QM970_RS02155 WP_003224994.1 427984..428106(+) (phrC) [Bacillus subtilis strain ZKY03]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=765488 QM970_RS02155 WP_003224994.1 427984..428106(+) (phrC) [Bacillus subtilis strain ZKY03]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1