Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QMY17_RS20035 Genome accession   NZ_CP125812
Coordinates   3726557..3726679 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain N3378-3At     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 3721557..3731679
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QMY17_RS20005 yclP 3721624..3722382 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  QMY17_RS20010 yclO 3722376..3723323 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  QMY17_RS20015 ceuB 3723316..3724266 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  QMY17_RS20020 thrD 3724657..3726021 (+) 1365 WP_014478832.1 aspartate kinase -
  QMY17_RS20025 yczN 3726174..3726287 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  QMY17_RS20030 yczM 3726369..3726458 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  QMY17_RS20035 phrC 3726557..3726679 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QMY17_RS20040 rapC 3726663..3727811 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  QMY17_RS20045 yclK 3727974..3729395 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  QMY17_RS20050 yclJ 3729382..3730065 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=764207 QMY17_RS20035 WP_003224994.1 3726557..3726679(-) (phrC) [Bacillus subtilis strain N3378-3At]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=764207 QMY17_RS20035 WP_003224994.1 3726557..3726679(-) (phrC) [Bacillus subtilis strain N3378-3At]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1