Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ORP33_RS02160 Genome accession   NZ_CP113256
Coordinates   424785..424907 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain K1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 419785..429907
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ORP33_RS02145 (ORP33_02115) yclJ 421399..422082 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ORP33_RS02150 (ORP33_02120) yclK 422069..423490 (+) 1422 WP_213414881.1 sensor histidine kinase -
  ORP33_RS02155 (ORP33_02125) rapC 423653..424801 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  ORP33_RS02160 (ORP33_02130) phrC 424785..424907 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ORP33_RS02165 (ORP33_02135) yczM 425007..425096 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ORP33_RS02170 (ORP33_02140) yczN 425178..425291 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  ORP33_RS02175 (ORP33_02145) thrD 425445..426809 (-) 1365 WP_033883679.1 aspartate kinase -
  ORP33_RS02180 (ORP33_02150) ceuB 427194..428144 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ORP33_RS02185 (ORP33_02155) yclO 428137..429084 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ORP33_RS02190 (ORP33_02160) yclP 429078..429836 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=761229 ORP33_RS02160 WP_003224994.1 424785..424907(+) (phrC) [Bacillus subtilis strain K1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=761229 ORP33_RS02160 WP_003224994.1 424785..424907(+) (phrC) [Bacillus subtilis strain K1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1