Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   OOZ27_RS02545 Genome accession   NZ_CP110634
Coordinates   483090..483212 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain MG-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 478090..488212
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  OOZ27_RS02530 (OOZ27_02530) yclJ 479704..480387 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  OOZ27_RS02535 (OOZ27_02535) yclK 480374..481795 (+) 1422 WP_074794501.1 two-component system sensor histidine kinase YclK -
  OOZ27_RS02540 (OOZ27_02540) rapC 481958..483106 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  OOZ27_RS02545 (OOZ27_02545) phrC 483090..483212 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  OOZ27_RS02550 (OOZ27_02550) yczM 483312..483401 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  OOZ27_RS02555 (OOZ27_02555) yczN 483483..483596 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  OOZ27_RS02560 (OOZ27_02560) thrD 483749..485113 (-) 1365 WP_015715246.1 aspartate kinase -
  OOZ27_RS02565 (OOZ27_02565) ceuB 485498..486448 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  OOZ27_RS02570 (OOZ27_02570) yclO 486441..487388 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  OOZ27_RS02575 (OOZ27_02575) yclP 487382..488140 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=755471 OOZ27_RS02545 WP_003224994.1 483090..483212(+) (phrC) [Bacillus subtilis strain MG-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=755471 OOZ27_RS02545 WP_003224994.1 483090..483212(+) (phrC) [Bacillus subtilis strain MG-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1