Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   K6K00_RS02080 Genome accession   NZ_AP024628
Coordinates   420459..420581 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BEST3145     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 415459..425581
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  K6K00_RS02065 (BsBEST3145_03870) yclJ 417073..417756 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  K6K00_RS02070 (BsBEST3145_03880) yclK 417743..419164 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  K6K00_RS02075 (BsBEST3145_03890) rapC 419327..420475 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  K6K00_RS02080 (BsBEST3145_03900) phrC 420459..420581 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  K6K00_RS02085 yczM 420681..420770 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  K6K00_RS02090 yczN 420852..420965 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  K6K00_RS02095 (BsBEST3145_03910) thrD 421119..422483 (-) 1365 WP_009966541.1 aspartate kinase -
  K6K00_RS02100 (BsBEST3145_03920) ceuB 422868..423818 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  K6K00_RS02105 (BsBEST3145_03930) yclO 423811..424758 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  K6K00_RS02110 (BsBEST3145_03940) yclP 424752..425510 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=74593 K6K00_RS02080 WP_003224994.1 420459..420581(+) (phrC) [Bacillus subtilis strain BEST3145]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=74593 K6K00_RS02080 WP_003224994.1 420459..420581(+) (phrC) [Bacillus subtilis strain BEST3145]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1