Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   P4831_RS11775 Genome accession   NZ_CP120842
Coordinates   2274624..2274920 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   Q9CDU2
Organism   Lactococcus lactis strain ZFM559     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2269624..2279920
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  P4831_RS11745 - 2270819..2271628 (-) 810 WP_010906310.1 metal ABC transporter permease -
  P4831_RS11750 - 2271621..2272358 (-) 738 WP_277812508.1 metal ABC transporter ATP-binding protein -
  P4831_RS11755 - 2272535..2273377 (-) 843 WP_015427160.1 metal ABC transporter substrate-binding protein -
  P4831_RS11760 - 2273374..2273811 (-) 438 WP_010906313.1 zinc-dependent MarR family transcriptional regulator -
  P4831_RS11765 comGG 2273892..2274176 (-) 285 WP_010906314.1 competence type IV pilus minor pilin ComGG Machinery gene
  P4831_RS11770 comGF 2274215..2274661 (-) 447 WP_031558968.1 competence type IV pilus minor pilin ComGF Machinery gene
  P4831_RS11775 comGE 2274624..2274920 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  P4831_RS11780 comGD 2274892..2275308 (-) 417 WP_225509978.1 competence type IV pilus minor pilin ComGD Machinery gene
  P4831_RS11785 comGC 2275283..2275552 (-) 270 WP_023349160.1 competence type IV pilus major pilin ComGC Machinery gene
  P4831_RS11795 - 2275952..2276017 (-) 66 WP_228762923.1 hypothetical protein -
  P4831_RS11800 - 2276385..2277164 (-) 780 WP_058220347.1 peptidoglycan amidohydrolase family protein -
  P4831_RS11805 - 2277164..2277451 (-) 288 WP_023164507.1 phage holin -
  P4831_RS11810 - 2277464..2277814 (-) 351 WP_277812509.1 hypothetical protein -
  P4831_RS11815 - 2277827..2278057 (-) 231 WP_058213223.1 hypothetical protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=734527 P4831_RS11775 WP_010906316.1 2274624..2274920(-) (comGE) [Lactococcus lactis strain ZFM559]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=734527 P4831_RS11775 WP_010906316.1 2274624..2274920(-) (comGE) [Lactococcus lactis strain ZFM559]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q9CDU2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673