Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   P5622_RS01075 Genome accession   NZ_CP120598
Coordinates   189638..189760 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PRO115     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 184638..194760
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  P5622_RS01045 (P5622_01045) yclP 184709..185467 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  P5622_RS01050 (P5622_01050) yclO 185461..186408 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  P5622_RS01055 (P5622_01055) ceuB 186401..187351 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  P5622_RS01060 (P5622_01060) thrD 187736..189100 (+) 1365 WP_003234493.1 aspartate kinase -
  P5622_RS01065 (P5622_01065) yczN 189254..189367 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  P5622_RS01070 (P5622_01070) yczM 189449..189538 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  P5622_RS01075 (P5622_01075) phrC 189638..189760 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  P5622_RS01080 (P5622_01080) rapC 189744..190892 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  P5622_RS01085 (P5622_01085) yclK 191055..192476 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  P5622_RS01090 (P5622_01090) yclJ 192463..193146 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=732771 P5622_RS01075 WP_003224994.1 189638..189760(-) (phrC) [Bacillus subtilis strain PRO115]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=732771 P5622_RS01075 WP_003224994.1 189638..189760(-) (phrC) [Bacillus subtilis strain PRO115]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1