Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NX050_RS19895 Genome accession   NZ_CP103456
Coordinates   3694260..3694382 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PN176 (HK176)     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3689260..3699382
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NX050_RS19865 (NX050_19865) yclP 3689327..3690085 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  NX050_RS19870 (NX050_19870) yclO 3690079..3691026 (-) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  NX050_RS19875 (NX050_19875) ceuB 3691019..3691969 (-) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NX050_RS19880 (NX050_19880) thrD 3692360..3693724 (+) 1365 WP_014478832.1 aspartate kinase -
  NX050_RS19885 (NX050_19885) yczN 3693877..3693990 (+) 114 WP_014478831.1 YjcZ family sporulation protein -
  NX050_RS19890 (NX050_19890) yczM 3694072..3694161 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  NX050_RS19895 (NX050_19895) phrC 3694260..3694382 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NX050_RS19900 (NX050_19900) rapC 3694366..3695514 (-) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NX050_RS19905 (NX050_19905) yclK 3695677..3697098 (-) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  NX050_RS19910 (NX050_19910) yclJ 3697085..3697768 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=722912 NX050_RS19895 WP_003224994.1 3694260..3694382(-) (phrC) [Bacillus subtilis strain PN176 (HK176)]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=722912 NX050_RS19895 WP_003224994.1 3694260..3694382(-) (phrC) [Bacillus subtilis strain PN176 (HK176)]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1