Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NX823_RS02170 Genome accession   NZ_CP103352
Coordinates   445152..445274 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM117508     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 440152..450274
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NX823_RS02155 (NX823_02155) yclJ 441765..442448 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NX823_RS02160 (NX823_02160) yclK 442435..443856 (+) 1422 WP_080317125.1 two-component system sensor histidine kinase YclK -
  NX823_RS02165 (NX823_02165) rapC 444020..445168 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NX823_RS02170 (NX823_02170) phrC 445152..445274 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NX823_RS02175 (NX823_02175) yczM 445373..445462 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NX823_RS02180 (NX823_02180) yczN 445544..445657 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  NX823_RS02185 (NX823_02185) thrD 445810..447174 (-) 1365 WP_021481755.1 aspartate kinase -
  NX823_RS02190 (NX823_02190) ceuB 447565..448515 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NX823_RS02195 (NX823_02195) yclO 448508..449455 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  NX823_RS02200 (NX823_02200) yclP 449449..450207 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=722268 NX823_RS02170 WP_003224994.1 445152..445274(+) (phrC) [Bacillus subtilis strain SRCM117508]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=722268 NX823_RS02170 WP_003224994.1 445152..445274(+) (phrC) [Bacillus subtilis strain SRCM117508]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1