Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NX819_RS02550 Genome accession   NZ_CP103351
Coordinates   482654..482776 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM115947     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 477654..487776
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NX819_RS02535 (NX819_02535) yclJ 479267..479950 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NX819_RS02540 (NX819_02540) yclK 479937..481358 (+) 1422 WP_080479511.1 two-component system sensor histidine kinase YclK -
  NX819_RS02545 (NX819_02545) rapC 481522..482670 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  NX819_RS02550 (NX819_02550) phrC 482654..482776 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NX819_RS02555 (NX819_02555) yczM 482876..482965 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NX819_RS02560 (NX819_02560) yczN 483047..483160 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NX819_RS02565 (NX819_02565) thrD 483314..484678 (-) 1365 WP_110109576.1 aspartate kinase -
  NX819_RS02570 (NX819_02570) ceuB 485063..486013 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NX819_RS02575 (NX819_02575) yclO 486006..486953 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  NX819_RS02580 (NX819_02580) yclP 486947..487705 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=722188 NX819_RS02550 WP_003224994.1 482654..482776(+) (phrC) [Bacillus subtilis strain SRCM115947]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=722188 NX819_RS02550 WP_003224994.1 482654..482776(+) (phrC) [Bacillus subtilis strain SRCM115947]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1