Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NX062_RS02170 Genome accession   NZ_CP103328
Coordinates   427089..427211 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain KC14-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 422089..432211
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NX062_RS02155 (NX062_02155) yclJ 423703..424386 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NX062_RS02160 (NX062_02160) yclK 424373..425794 (+) 1422 WP_080348068.1 two-component system sensor histidine kinase YclK -
  NX062_RS02165 (NX062_02165) rapC 425957..427105 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NX062_RS02170 (NX062_02170) phrC 427089..427211 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NX062_RS02175 (NX062_02175) yczM 427311..427400 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NX062_RS02180 (NX062_02180) yczN 427482..427595 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  NX062_RS02185 (NX062_02185) thrD 427748..429112 (-) 1365 WP_129110440.1 aspartate kinase -
  NX062_RS02190 (NX062_02190) ceuB 429497..430447 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NX062_RS02195 (NX062_02195) yclO 430440..431387 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NX062_RS02200 (NX062_02200) yclP 431381..432139 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=721952 NX062_RS02170 WP_003224994.1 427089..427211(+) (phrC) [Bacillus subtilis strain KC14-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=721952 NX062_RS02170 WP_003224994.1 427089..427211(+) (phrC) [Bacillus subtilis strain KC14-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1