Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NP436_RS02160 Genome accession   NZ_CP101932
Coordinates   427393..427515 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. natto strain BGSC 27E1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 422393..432515
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NP436_RS02145 (NP436_02145) yclJ 424007..424690 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NP436_RS02150 (NP436_02150) yclK 424677..426098 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  NP436_RS02155 (NP436_02155) rapC 426261..427409 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NP436_RS02160 (NP436_02160) phrC 427393..427515 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NP436_RS02165 (NP436_02165) yczM 427614..427703 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NP436_RS02170 (NP436_02170) yczN 427785..427898 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  NP436_RS02175 (NP436_02175) thrD 428051..429415 (-) 1365 WP_014478832.1 aspartate kinase -
  NP436_RS02180 (NP436_02180) ceuB 429806..430756 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NP436_RS02185 (NP436_02185) yclO 430749..431696 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  NP436_RS02190 (NP436_02190) yclP 431690..432448 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=713131 NP436_RS02160 WP_003224994.1 427393..427515(+) (phrC) [Bacillus subtilis subsp. natto strain BGSC 27E1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=713131 NP436_RS02160 WP_003224994.1 427393..427515(+) (phrC) [Bacillus subtilis subsp. natto strain BGSC 27E1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1