Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   NLK52_RS02120 Genome accession   NZ_CP100436
Coordinates   421182..421304 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain MEC_B298     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 416182..426304
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NLK52_RS02105 (NLK52_02105) yclJ 417795..418478 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  NLK52_RS02110 (NLK52_02110) yclK 418465..419886 (+) 1422 WP_080030630.1 two-component system sensor histidine kinase YclK -
  NLK52_RS02115 (NLK52_02115) rapC 420050..421198 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NLK52_RS02120 (NLK52_02120) phrC 421182..421304 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NLK52_RS02125 (NLK52_02125) yczM 421404..421493 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NLK52_RS02130 (NLK52_02130) yczN 421575..421688 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  NLK52_RS02135 (NLK52_02135) thrD 421841..423205 (-) 1365 WP_015382767.1 aspartate kinase -
  NLK52_RS02140 (NLK52_02140) ceuB 423590..424540 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  NLK52_RS02145 (NLK52_02145) yclO 424533..425480 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  NLK52_RS02150 (NLK52_02150) yclP 425474..426232 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=705402 NLK52_RS02120 WP_003224994.1 421182..421304(+) (phrC) [Bacillus subtilis strain MEC_B298]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=705402 NLK52_RS02120 WP_003224994.1 421182..421304(+) (phrC) [Bacillus subtilis strain MEC_B298]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1