Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NCL52_RS02190 Genome accession   NZ_CP098417
Coordinates   430111..430233 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain N2-10     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 425111..435233
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NCL52_RS02175 (NCL52_02175) yclJ 426724..427407 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NCL52_RS02180 (NCL52_02180) yclK 427394..428815 (+) 1422 WP_086343454.1 two-component system sensor histidine kinase YclK -
  NCL52_RS02185 (NCL52_02185) rapC 428979..430127 (+) 1149 WP_086343455.1 response regulator aspartate phosphatase RapC Regulator
  NCL52_RS02190 (NCL52_02190) phrC 430111..430233 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NCL52_RS02195 (NCL52_02195) yczM 430331..430420 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NCL52_RS02200 (NCL52_02200) yczN 430502..430615 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  NCL52_RS02205 (NCL52_02205) thrD 430768..432132 (-) 1365 WP_086343456.1 aspartate kinase -
  NCL52_RS02210 (NCL52_02210) ceuB 432517..433467 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NCL52_RS02215 (NCL52_02215) yclO 433460..434407 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NCL52_RS02220 (NCL52_02220) yclP 434401..435159 (+) 759 WP_086343457.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=695351 NCL52_RS02190 WP_003224994.1 430111..430233(+) (phrC) [Bacillus subtilis strain N2-10]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=695351 NCL52_RS02190 WP_003224994.1 430111..430233(+) (phrC) [Bacillus subtilis strain N2-10]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1