Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   M2M89_RS02155 Genome accession   NZ_CP097130
Coordinates   432656..432778 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain S16     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 427656..437778
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  M2M89_RS02140 yclJ 429269..429952 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  M2M89_RS02145 yclK 429939..431360 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  M2M89_RS02150 rapC 431524..432672 (+) 1149 WP_038828432.1 response regulator aspartate phosphatase RapC Regulator
  M2M89_RS02155 phrC 432656..432778 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  M2M89_RS02160 yczM 432878..432967 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  M2M89_RS02165 yczN 433049..433162 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  M2M89_RS02170 thrD 433315..434679 (-) 1365 WP_072173982.1 aspartate kinase -
  M2M89_RS02175 ceuB 435064..436014 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  M2M89_RS02180 yclO 436007..436954 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  M2M89_RS02185 yclP 436948..437706 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=687401 M2M89_RS02155 WP_003224994.1 432656..432778(+) (phrC) [Bacillus subtilis strain S16]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=687401 M2M89_RS02155 WP_003224994.1 432656..432778(+) (phrC) [Bacillus subtilis strain S16]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1