Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   MX663_RS02285 Genome accession   NZ_CP095736
Coordinates   443451..443573 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain N4     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 438451..448573
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MX663_RS02270 (MX663_02270) yclJ 440065..440748 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  MX663_RS02275 (MX663_02275) yclK 440735..442156 (+) 1422 WP_247471224.1 two-component system sensor histidine kinase YclK -
  MX663_RS02280 (MX663_02280) rapC 442319..443467 (+) 1149 WP_122895033.1 response regulator aspartate phosphatase RapC Regulator
  MX663_RS02285 (MX663_02285) phrC 443451..443573 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MX663_RS02290 (MX663_02290) yczM 443673..443762 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MX663_RS02295 (MX663_02295) yczN 443844..443957 (-) 114 WP_032728921.1 YjcZ family sporulation protein -
  MX663_RS02300 (MX663_02300) thrD 444110..445474 (-) 1365 WP_247471225.1 aspartate kinase -
  MX663_RS02305 (MX663_02305) ceuB 445859..446809 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  MX663_RS02310 (MX663_02310) yclO 446802..447749 (+) 948 WP_247471227.1 petrobactin ABC transporter permease YclO -
  MX663_RS02315 (MX663_02315) yclP 447743..448501 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=677832 MX663_RS02285 WP_003224994.1 443451..443573(+) (phrC) [Bacillus subtilis strain N4]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=677832 MX663_RS02285 WP_003224994.1 443451..443573(+) (phrC) [Bacillus subtilis strain N4]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1