Detailed information    

insolico Bioinformatically predicted

Overview


Name   dinR/lexA   Type   Regulator
Locus tag   OHB10_RS07555 Genome accession   NZ_CP109319
Coordinates   1536310..1536534 (+) Length   74 a.a.
NCBI ID   WP_266842847.1    Uniprot ID   -
Organism   Streptomyces sp. NBC_01597     
Function   repressor of recA; repressor of dinR (predicted from homology)   
Homologous recombination

Genomic Context


Location: 1531310..1541534
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  OHB10_RS07520 (OHB10_07450) - 1531365..1531634 (+) 270 Protein_1499 DNA cytosine methyltransferase -
  OHB10_RS07525 (OHB10_07455) - 1532172..1532309 (+) 138 WP_266844890.1 hypothetical protein -
  OHB10_RS07530 (OHB10_07460) - 1532405..1533004 (+) 600 WP_266842837.1 DUF4913 domain-containing protein -
  OHB10_RS07535 (OHB10_07465) - 1533006..1533812 (+) 807 WP_266842839.1 hypothetical protein -
  OHB10_RS07540 (OHB10_07470) - 1533809..1534294 (+) 486 WP_266842841.1 hypothetical protein -
  OHB10_RS07545 (OHB10_07475) - 1534327..1535118 (+) 792 WP_266842843.1 winged helix-turn-helix transcriptional regulator -
  OHB10_RS07550 (OHB10_07480) - 1535217..1536071 (+) 855 WP_266842845.1 DUF317 domain-containing protein -
  OHB10_RS07555 (OHB10_07485) dinR/lexA 1536310..1536534 (+) 225 WP_266842847.1 hypothetical protein Regulator
  OHB10_RS07560 (OHB10_07490) - 1536597..1536752 (-) 156 WP_266842849.1 hypothetical protein -
  OHB10_RS07565 (OHB10_07495) - 1537070..1537342 (+) 273 WP_266842851.1 DUF317 domain-containing protein -
  OHB10_RS07570 (OHB10_07500) - 1537379..1537603 (+) 225 WP_266842853.1 hypothetical protein -
  OHB10_RS07575 (OHB10_07505) - 1537852..1538028 (+) 177 WP_266842855.1 hypothetical protein -
  OHB10_RS07580 (OHB10_07510) - 1538154..1538465 (-) 312 WP_266842856.1 hypothetical protein -
  OHB10_RS07585 (OHB10_07515) - 1538662..1538865 (-) 204 WP_266842858.1 DUF397 domain-containing protein -
  OHB10_RS07590 (OHB10_07520) - 1538979..1539125 (+) 147 WP_266927359.1 hypothetical protein -
  OHB10_RS07595 (OHB10_07525) - 1539194..1539583 (+) 390 WP_266842860.1 hypothetical protein -
  OHB10_RS07600 (OHB10_07530) - 1539707..1540114 (-) 408 WP_266842862.1 hypothetical protein -

Sequence


Protein


Download         Length: 74 a.a.        Molecular weight: 8546.82 Da        Isoelectric Point: 10.5801

>NTDB_id=674065 OHB10_RS07555 WP_266842847.1 1536310..1536534(+) (dinR/lexA) [Streptomyces sp. NBC_01597]
MVNRRVDYLTSTQEHILRCIRESIADRGEAPTVKEIGQQLGMRSTASVHWHLSRMETLGYIAREPRTPRGIRLT

Nucleotide


Download         Length: 225 bp        

>NTDB_id=674065 OHB10_RS07555 WP_266842847.1 1536310..1536534(+) (dinR/lexA) [Streptomyces sp. NBC_01597]
ATGGTGAACCGCAGGGTCGACTACCTCACCAGCACCCAGGAGCACATCCTCCGCTGCATCCGCGAGTCGATCGCCGACCG
AGGCGAAGCGCCTACCGTCAAGGAGATCGGCCAGCAACTCGGCATGCGCAGCACGGCCTCAGTGCACTGGCACCTCAGCC
GCATGGAGACTCTTGGCTACATCGCCCGCGAGCCCCGCACACCACGCGGAATCCGGCTCACATGA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  dinR/lexA Bacillus subtilis subsp. subtilis str. 168

43.077

87.838

0.378