Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   MOW04_RS02195 Genome accession   NZ_CP093546
Coordinates   430557..430679 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. K1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 425557..435679
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MOW04_RS02180 yclJ 427171..427854 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  MOW04_RS02185 yclK 427841..429262 (+) 1422 WP_163131651.1 two-component system sensor histidine kinase YclK -
  MOW04_RS02190 rapC 429425..430573 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  MOW04_RS02195 phrC 430557..430679 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MOW04_RS02200 - 430779..430868 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MOW04_RS02205 - 430950..431063 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  MOW04_RS02210 - 431217..432581 (-) 1365 WP_128992406.1 aspartate kinase -
  MOW04_RS02215 ceuB 432966..433916 (+) 951 WP_163131649.1 petrobactin ABC transporter permease YclN Machinery gene
  MOW04_RS02220 yclO 433909..434856 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  MOW04_RS02225 yclP 434850..435608 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=665116 MOW04_RS02195 WP_003224994.1 430557..430679(+) (phrC) [Bacillus sp. K1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=665116 MOW04_RS02195 WP_003224994.1 430557..430679(+) (phrC) [Bacillus sp. K1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1