Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   MNG38_RS02540 Genome accession   NZ_CP093289
Coordinates   482280..482402 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain H2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 477280..487402
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MNG38_RS02525 (MNG38_02525) yclJ 478894..479577 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  MNG38_RS02530 (MNG38_02530) yclK 479564..480985 (+) 1422 WP_080348068.1 two-component system sensor histidine kinase YclK -
  MNG38_RS02535 (MNG38_02535) rapC 481148..482296 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  MNG38_RS02540 (MNG38_02540) phrC 482280..482402 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MNG38_RS02545 (MNG38_02545) yczM 482502..482591 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MNG38_RS02550 (MNG38_02550) yczN 482673..482786 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  MNG38_RS02555 (MNG38_02555) thrD 482939..484303 (-) 1365 WP_029726569.1 aspartate kinase -
  MNG38_RS02560 (MNG38_02560) ceuB 484688..485638 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  MNG38_RS02565 (MNG38_02565) yclO 485631..486578 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  MNG38_RS02570 (MNG38_02570) yclP 486572..487330 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=662957 MNG38_RS02540 WP_003224994.1 482280..482402(+) (phrC) [Bacillus subtilis strain H2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=662957 MNG38_RS02540 WP_003224994.1 482280..482402(+) (phrC) [Bacillus subtilis strain H2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1