Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   MM522_RS20935 Genome accession   NZ_CP093067
Coordinates   4072685..4072807 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ATC-3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 4067685..4077807
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MM522_RS20920 (MM522_20920) yclJ 4069298..4069981 (+) 684 WP_224912755.1 two-component system response regulator YclJ -
  MM522_RS20925 (MM522_20925) yclK 4069968..4071389 (+) 1422 WP_241495684.1 two-component system sensor histidine kinase YclK -
  MM522_RS20930 (MM522_20930) rapC 4071553..4072701 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  MM522_RS20935 (MM522_20935) phrC 4072685..4072807 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MM522_RS20940 (MM522_20940) yczM 4072907..4072996 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MM522_RS20945 (MM522_20945) yczN 4073078..4073191 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  MM522_RS20950 (MM522_20950) thrD 4073345..4074709 (-) 1365 WP_038428355.1 aspartate kinase -
  MM522_RS20955 (MM522_20955) ceuB 4075094..4076044 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  MM522_RS20960 (MM522_20960) yclO 4076037..4076984 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  MM522_RS20965 (MM522_20965) yclP 4076978..4077736 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=661889 MM522_RS20935 WP_003224994.1 4072685..4072807(+) (phrC) [Bacillus subtilis strain ATC-3]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=661889 MM522_RS20935 WP_003224994.1 4072685..4072807(+) (phrC) [Bacillus subtilis strain ATC-3]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1