Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   MK848_RS15615 Genome accession   NZ_CP092824
Coordinates   3057780..3057902 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain S1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3052780..3062902
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MK848_RS15600 (MK848_15585) yclJ 3054393..3055076 (+) 684 WP_224912755.1 two-component system response regulator YclJ -
  MK848_RS15605 (MK848_15590) yclK 3055063..3056484 (+) 1422 WP_241495684.1 two-component system sensor histidine kinase YclK -
  MK848_RS15610 (MK848_15595) rapC 3056648..3057796 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  MK848_RS15615 (MK848_15600) phrC 3057780..3057902 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MK848_RS15620 (MK848_15605) yczM 3058002..3058091 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MK848_RS15625 (MK848_15610) yczN 3058173..3058286 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  MK848_RS15630 (MK848_15615) thrD 3058440..3059804 (-) 1365 WP_038428355.1 aspartate kinase -
  MK848_RS15635 (MK848_15620) ceuB 3060189..3061139 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  MK848_RS15640 (MK848_15625) yclO 3061132..3062079 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  MK848_RS15645 (MK848_15630) yclP 3062073..3062831 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=660456 MK848_RS15615 WP_003224994.1 3057780..3057902(+) (phrC) [Bacillus subtilis strain S1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=660456 MK848_RS15615 WP_003224994.1 3057780..3057902(+) (phrC) [Bacillus subtilis strain S1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1