Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   MAK48_RS02175 Genome accession   NZ_CP091872
Coordinates   429683..429805 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. Man122     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424683..434805
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MAK48_RS02160 (MAK48_02160) yclJ 426297..426980 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  MAK48_RS02165 (MAK48_02165) yclK 426967..428388 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  MAK48_RS02170 (MAK48_02170) rapC 428551..429699 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  MAK48_RS02175 (MAK48_02175) phrC 429683..429805 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MAK48_RS02180 (MAK48_02180) - 429905..429994 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MAK48_RS02185 (MAK48_02185) - 430076..430189 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  MAK48_RS02190 (MAK48_02190) - 430343..431707 (-) 1365 WP_003234493.1 aspartate kinase -
  MAK48_RS02195 (MAK48_02195) ceuB 432092..433042 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  MAK48_RS02200 (MAK48_02200) yclO 433035..433982 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  MAK48_RS02205 (MAK48_02205) yclP 433976..434734 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=653996 MAK48_RS02175 WP_003224994.1 429683..429805(+) (phrC) [Bacillus sp. Man122]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=653996 MAK48_RS02175 WP_003224994.1 429683..429805(+) (phrC) [Bacillus sp. Man122]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1