Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   LXE94_RS02335 Genome accession   NZ_CP090125
Coordinates   458080..458202 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain Bs96     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 453080..463202
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LXE94_RS02320 (LXE94_02315) yclJ 454693..455376 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  LXE94_RS02325 (LXE94_02320) yclK 455363..456784 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  LXE94_RS02330 (LXE94_02325) rapC 456948..458096 (+) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  LXE94_RS02335 (LXE94_02330) phrC 458080..458202 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  LXE94_RS02340 (LXE94_02335) yczM 458302..458391 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  LXE94_RS02345 (LXE94_02340) yczN 458473..458586 (-) 114 WP_257986421.1 YjcZ family sporulation protein -
  LXE94_RS02350 (LXE94_02345) thrD 458740..460104 (-) 1365 WP_033883679.1 aspartate kinase -
  LXE94_RS02355 (LXE94_02350) ceuB 460489..461439 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  LXE94_RS02360 (LXE94_02355) yclO 461432..462379 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  LXE94_RS02365 (LXE94_02360) yclP 462373..463131 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=640668 LXE94_RS02335 WP_003224994.1 458080..458202(+) (phrC) [Bacillus subtilis strain Bs96]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=640668 LXE94_RS02335 WP_003224994.1 458080..458202(+) (phrC) [Bacillus subtilis strain Bs96]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1