Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   N7985_RS02130 Genome accession   NZ_CP106673
Coordinates   421015..421137 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SRCM116268     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416015..426137
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  N7985_RS02115 (N7985_02115) yclJ 417628..418311 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  N7985_RS02120 (N7985_02120) yclK 418298..419719 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  N7985_RS02125 (N7985_02125) rapC 419883..421031 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  N7985_RS02130 (N7985_02130) phrC 421015..421137 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  N7985_RS02135 (N7985_02135) yczM 421239..421328 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  N7985_RS02140 (N7985_02140) yczN 421410..421523 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  N7985_RS02145 (N7985_02145) thrD 421677..423041 (-) 1365 WP_043940054.1 aspartate kinase -
  N7985_RS02150 (N7985_02150) ceuB 423426..424376 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  N7985_RS02155 (N7985_02155) yclO 424369..425316 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  N7985_RS02160 (N7985_02160) yclP 425310..426068 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=635442 N7985_RS02130 WP_003224994.1 421015..421137(+) (phrC) [Bacillus subtilis strain SRCM116268]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=635442 N7985_RS02130 WP_003224994.1 421015..421137(+) (phrC) [Bacillus subtilis strain SRCM116268]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1