Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   N8A75_RS02170 Genome accession   NZ_CP104878
Coordinates   427086..427208 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain 4ZT     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 422086..432208
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  N8A75_RS02155 (N8A75_02155) yclJ 423700..424383 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  N8A75_RS02160 (N8A75_02160) yclK 424370..425791 (+) 1422 WP_080348068.1 two-component system sensor histidine kinase YclK -
  N8A75_RS02165 (N8A75_02165) rapC 425954..427102 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  N8A75_RS02170 (N8A75_02170) phrC 427086..427208 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  N8A75_RS02175 (N8A75_02175) yczM 427308..427397 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  N8A75_RS02180 (N8A75_02180) yczN 427479..427592 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  N8A75_RS02185 (N8A75_02185) thrD 427745..429109 (-) 1365 WP_129110440.1 aspartate kinase -
  N8A75_RS02190 (N8A75_02190) ceuB 429494..430444 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  N8A75_RS02195 (N8A75_02195) yclO 430437..431384 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  N8A75_RS02200 (N8A75_02200) yclP 431378..432136 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=634480 N8A75_RS02170 WP_003224994.1 427086..427208(+) (phrC) [Bacillus subtilis strain 4ZT]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=634480 N8A75_RS02170 WP_003224994.1 427086..427208(+) (phrC) [Bacillus subtilis strain 4ZT]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1