Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   N6G78_RS02125 Genome accession   NZ_CP104855
Coordinates   421115..421237 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain TY-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416115..426237
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  N6G78_RS02110 (N6G78_02110) yclJ 417728..418411 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  N6G78_RS02115 (N6G78_02115) yclK 418398..419819 (+) 1422 WP_080030630.1 two-component system sensor histidine kinase YclK -
  N6G78_RS02120 (N6G78_02120) rapC 419983..421131 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  N6G78_RS02125 (N6G78_02125) phrC 421115..421237 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  N6G78_RS02130 (N6G78_02130) yczM 421337..421426 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  N6G78_RS02135 (N6G78_02135) yczN 421508..421621 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  N6G78_RS02140 (N6G78_02140) thrD 421774..423138 (-) 1365 WP_015382767.1 aspartate kinase -
  N6G78_RS02145 (N6G78_02145) ceuB 423523..424473 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  N6G78_RS02150 (N6G78_02150) yclO 424466..425413 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  N6G78_RS02155 (N6G78_02155) yclP 425407..426165 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=633726 N6G78_RS02125 WP_003224994.1 421115..421237(+) (phrC) [Bacillus subtilis strain TY-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=633726 N6G78_RS02125 WP_003224994.1 421115..421237(+) (phrC) [Bacillus subtilis strain TY-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1