Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   N4R43_RS01335 Genome accession   NZ_CP104388
Coordinates   234001..234297 (-) Length   98 a.a.
NCBI ID   WP_058223572.1    Uniprot ID   -
Organism   Lactococcus lactis strain LJL7m20     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 229001..239297
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  N4R43_RS01300 (N4R43_01300) - 229291..230157 (+) 867 WP_058204413.1 RluA family pseudouridine synthase -
  N4R43_RS01305 (N4R43_01305) - 230195..231004 (-) 810 WP_014570791.1 metal ABC transporter permease -
  N4R43_RS01310 (N4R43_01310) - 230997..231734 (-) 738 WP_012898617.1 metal ABC transporter ATP-binding protein -
  N4R43_RS01315 (N4R43_01315) - 231911..232753 (-) 843 WP_015427160.1 metal ABC transporter substrate-binding protein -
  N4R43_RS01320 (N4R43_01320) - 232750..233187 (-) 438 WP_003129992.1 zinc-dependent MarR family transcriptional regulator -
  N4R43_RS01325 (N4R43_01325) comGG 233269..233553 (-) 285 WP_025017139.1 competence type IV pilus minor pilin ComGG Machinery gene
  N4R43_RS01330 (N4R43_01330) comGF 233592..234038 (-) 447 WP_029344525.1 competence type IV pilus minor pilin ComGF Machinery gene
  N4R43_RS01335 (N4R43_01335) comGE 234001..234297 (-) 297 WP_058223572.1 competence type IV pilus minor pilin ComGE Machinery gene
  N4R43_RS01340 (N4R43_01340) comGD 234269..234628 (-) 360 WP_023188582.1 competence type IV pilus minor pilin ComGD Machinery gene
  N4R43_RS01345 (N4R43_01345) comGC 234660..234956 (-) 297 WP_167593410.1 competence type IV pilus major pilin ComGC Machinery gene
  N4R43_RS01350 (N4R43_01350) - 235120..235245 (-) 126 WP_317141343.1 hypothetical protein -
  N4R43_RS01355 (N4R43_01355) - 235255..236034 (-) 780 WP_317141344.1 peptidoglycan amidohydrolase family protein -
  N4R43_RS01360 (N4R43_01360) - 236034..236321 (-) 288 WP_317141345.1 phage holin -
  N4R43_RS01365 (N4R43_01365) - 236335..236559 (-) 225 WP_010905920.1 hemolysin XhlA family protein -
  N4R43_RS01370 (N4R43_01370) - 236572..236808 (-) 237 WP_317141346.1 hypothetical protein -
  N4R43_RS12325 - 237353..238099 (-) 747 Protein_263 serine/threonine protein phosphatase -
  N4R43_RS01380 (N4R43_01380) - 238122..238295 (-) 174 WP_096819001.1 hypothetical protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11104.02 Da        Isoelectric Point: 7.2037

>NTDB_id=629199 N4R43_RS01335 WP_058223572.1 234001..234297(-) (comGE) [Lactococcus lactis strain LJL7m20]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLKELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=629199 N4R43_RS01335 WP_058223572.1 234001..234297(-) (comGE) [Lactococcus lactis strain LJL7m20]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAAAAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

67.01

98.98

0.663