Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NP435_RS02170 Genome accession   NZ_CP101937
Coordinates   429549..429671 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain RUB331     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424549..434671
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NP435_RS02155 (NP435_02155) yclJ 426163..426846 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NP435_RS02160 (NP435_02160) yclK 426833..428254 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  NP435_RS02165 (NP435_02165) rapC 428417..429565 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  NP435_RS02170 (NP435_02170) phrC 429549..429671 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NP435_RS02175 (NP435_02175) yczM 429771..429860 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NP435_RS02180 (NP435_02180) yczN 429942..430055 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NP435_RS02185 (NP435_02185) thrD 430209..431573 (-) 1365 WP_009966541.1 aspartate kinase -
  NP435_RS02190 (NP435_02190) ceuB 431958..432908 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  NP435_RS02195 (NP435_02195) yclO 432901..433848 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NP435_RS02200 (NP435_02200) yclP 433842..434600 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=613430 NP435_RS02170 WP_003224994.1 429549..429671(+) (phrC) [Bacillus subtilis strain RUB331]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=613430 NP435_RS02170 WP_003224994.1 429549..429671(+) (phrC) [Bacillus subtilis strain RUB331]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1