Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NP432_RS02280 Genome accession   NZ_CP101931
Coordinates   436918..437040 (+) Length   40 a.a.
NCBI ID   WP_256683206.1    Uniprot ID   -
Organism   Bacillus subtilis strain BGSC b98af     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 431918..442040
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NP432_RS02265 (NP432_02265) yclJ 433532..434215 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  NP432_RS02270 (NP432_02270) yclK 434202..435623 (+) 1422 WP_256683205.1 two-component system sensor histidine kinase YclK -
  NP432_RS02275 (NP432_02275) rapC 435786..436934 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NP432_RS02280 (NP432_02280) phrC 436918..437040 (+) 123 WP_256683206.1 phosphatase RapC inhibitor PhrC Regulator
  NP432_RS02285 (NP432_02285) yczM 437140..437229 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NP432_RS02290 (NP432_02290) yczN 437311..437424 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  NP432_RS02295 (NP432_02295) thrD 437578..438942 (-) 1365 WP_003234493.1 aspartate kinase -
  NP432_RS02300 (NP432_02300) ceuB 439327..440277 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NP432_RS02305 (NP432_02305) yclO 440270..441217 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  NP432_RS02310 (NP432_02310) yclP 441211..441969 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4241.99 Da        Isoelectric Point: 6.9710

>NTDB_id=612983 NP432_RS02280 WP_256683206.1 436918..437040(+) (phrC) [Bacillus subtilis strain BGSC b98af]
MKLKSKLFVICLAAAAIFTAAGVSDNAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=612983 NP432_RS02280 WP_256683206.1 436918..437040(+) (phrC) [Bacillus subtilis strain BGSC b98af]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGATAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975