Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NMT99_RS02160 Genome accession   NZ_CP101290
Coordinates   428186..428308 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain LjM2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 423186..433308
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NMT99_RS02145 yclJ 424800..425483 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  NMT99_RS02150 yclK 425470..426891 (+) 1422 WP_080477807.1 two-component system sensor histidine kinase YclK -
  NMT99_RS02155 rapC 427054..428202 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NMT99_RS02160 phrC 428186..428308 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NMT99_RS02165 yczM 428408..428497 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NMT99_RS02170 yczN 428579..428692 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  NMT99_RS02175 thrD 428845..430209 (-) 1365 WP_029726569.1 aspartate kinase -
  NMT99_RS02180 ceuB 430594..431544 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NMT99_RS02185 yclO 431537..432484 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  NMT99_RS02190 yclP 432478..433236 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=609947 NMT99_RS02160 WP_003224994.1 428186..428308(+) (phrC) [Bacillus subtilis strain LjM2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=609947 NMT99_RS02160 WP_003224994.1 428186..428308(+) (phrC) [Bacillus subtilis strain LjM2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1