Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   K4756_RS02120 Genome accession   NZ_CP081458
Coordinates   421112..421234 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain ps4060     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 416112..426234
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  K4756_RS02105 (K4756_02090) yclJ 417725..418408 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  K4756_RS02110 (K4756_02095) yclK 418395..419816 (+) 1422 WP_080030630.1 two-component system sensor histidine kinase YclK -
  K4756_RS02115 (K4756_02100) rapC 419980..421128 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  K4756_RS02120 (K4756_02105) phrC 421112..421234 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  K4756_RS02125 (K4756_02110) yczM 421334..421423 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  K4756_RS02130 (K4756_02115) yczN 421505..421618 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  K4756_RS02135 (K4756_02120) thrD 421771..423135 (-) 1365 WP_015382767.1 aspartate kinase -
  K4756_RS02140 (K4756_02125) ceuB 423520..424470 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  K4756_RS02145 (K4756_02130) yclO 424463..425410 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  K4756_RS02150 (K4756_02135) yclP 425404..426162 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=596475 K4756_RS02120 WP_003224994.1 421112..421234(+) (phrC) [Bacillus subtilis subsp. subtilis strain ps4060]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=596475 K4756_RS02120 WP_003224994.1 421112..421234(+) (phrC) [Bacillus subtilis subsp. subtilis strain ps4060]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1