Detailed information    

insolico Bioinformatically predicted

Overview

Name   rpoN/rpoN1   Type   Machinery gene
Locus tag   KY496_RS27475 Genome accession   NZ_CP080379
Coordinates   4734462..4734542 (+) Length   26 a.a.
NCBI ID   WP_373889483.1    Uniprot ID   -
Organism   Massilia sp. NP310     
Function   type IV pilus biogenesis and function (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 4729462..4739542
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KY496_RS20820 (KY496_20820) - 4730922..4731920 (+) 999 WP_219862233.1 SIS domain-containing protein -
  KY496_RS20825 (KY496_20825) - 4731920..4732474 (+) 555 WP_005663324.1 HAD family hydrolase -
  KY496_RS20830 (KY496_20830) lptC 4732485..4733090 (+) 606 WP_005663322.1 LPS export ABC transporter periplasmic protein LptC -
  KY496_RS20835 (KY496_20835) lptA 4733138..4733686 (+) 549 WP_005663321.1 lipopolysaccharide transport periplasmic protein LptA -
  KY496_RS20840 (KY496_20840) lptB 4733698..4734450 (+) 753 WP_040775454.1 LPS export ABC transporter ATP-binding protein -
  KY496_RS27475 rpoN/rpoN1 4734462..4734542 (+) 81 WP_373889483.1 hypothetical protein Machinery gene
  KY496_RS20845 (KY496_20845) rpoN/rpoN1 4734597..4735937 (+) 1341 WP_373889460.1 RNA polymerase factor sigma-54 Machinery gene
  KY496_RS20850 (KY496_20850) hpf 4736013..4736372 (+) 360 WP_005663316.1 ribosome hibernation-promoting factor, HPF/YfiA family -
  KY496_RS20855 (KY496_20855) - 4736496..4737581 (+) 1086 WP_219862235.1 enoyl-CoA hydratase/isomerase family protein -
  KY496_RS20860 (KY496_20860) - 4737666..4738736 (+) 1071 WP_219862237.1 DUF5694 domain-containing protein -
  KY496_RS20865 (KY496_20865) - 4738867..4739022 (+) 156 WP_005663310.1 hypothetical protein -

Sequence

Protein


Download         Length: 26 a.a.        Molecular weight: 3032.60 Da        Isoelectric Point: 12.5163

>NTDB_id=592442 KY496_RS27475 WP_373889483.1 4734462..4734542(+) (rpoN/rpoN1) [Massilia sp. NP310]
MKQSLQLRTSQHLALTPQLQQSIRLL

Nucleotide


Download         Length: 81 bp        

>NTDB_id=592442 KY496_RS27475 WP_373889483.1 4734462..4734542(+) (rpoN/rpoN1) [Massilia sp. NP310]
ATGAAACAGTCCCTGCAACTTCGCACTTCGCAGCACCTCGCGCTTACGCCGCAACTGCAGCAGTCGATCCGGTTGCTGTA
A

Domains

Predicted by InterproScan.

Sigma-54 factor, Activator interacting domain (AID) (Sigma54_AID)

(4-26)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  rpoN/rpoN1 Ralstonia pseudosolanacearum GMI1000

96.154

100

0.962