Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   KXZ66_RS02100 Genome accession   NZ_CP079759
Coordinates   418494..418616 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. LJBS17     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 413494..423616
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KXZ66_RS02085 (KXZ66_02085) yclJ 415107..415790 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  KXZ66_RS02090 (KXZ66_02090) yclK 415777..417198 (+) 1422 WP_077671293.1 two-component system sensor histidine kinase YclK -
  KXZ66_RS02095 (KXZ66_02095) rapC 417362..418510 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  KXZ66_RS02100 (KXZ66_02100) phrC 418494..418616 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KXZ66_RS02105 (KXZ66_02105) - 418715..418804 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KXZ66_RS02110 (KXZ66_02110) - 418886..418999 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  KXZ66_RS02115 (KXZ66_02115) - 419152..420516 (-) 1365 WP_015715246.1 aspartate kinase -
  KXZ66_RS02120 (KXZ66_02120) ceuB 420901..421851 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KXZ66_RS02125 (KXZ66_02125) yclO 421844..422791 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  KXZ66_RS02130 (KXZ66_02130) yclP 422785..423543 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=589290 KXZ66_RS02100 WP_003224994.1 418494..418616(+) (phrC) [Bacillus sp. LJBS17]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=589290 KXZ66_RS02100 WP_003224994.1 418494..418616(+) (phrC) [Bacillus sp. LJBS17]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1