Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KMZ16_RS02165 Genome accession   NZ_CP076445
Coordinates   428200..428322 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain ps4100     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 423200..433322
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KMZ16_RS02150 (KMZ16_02130) yclJ 424814..425497 (+) 684 WP_128480739.1 two-component system response regulator YclJ -
  KMZ16_RS02155 (KMZ16_02135) yclK 425484..426905 (+) 1422 WP_080477807.1 two-component system sensor histidine kinase YclK -
  KMZ16_RS02160 (KMZ16_02140) rapC 427068..428216 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  KMZ16_RS02165 (KMZ16_02145) phrC 428200..428322 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KMZ16_RS02170 (KMZ16_02150) yczM 428422..428511 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KMZ16_RS02175 (KMZ16_02155) yczN 428593..428706 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  KMZ16_RS02180 (KMZ16_02160) thrD 428859..430223 (-) 1365 WP_029726569.1 aspartate kinase -
  KMZ16_RS02185 (KMZ16_02165) ceuB 430608..431558 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KMZ16_RS02190 (KMZ16_02170) yclO 431551..432498 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  KMZ16_RS02195 (KMZ16_02175) yclP 432492..433250 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=575313 KMZ16_RS02165 WP_003224994.1 428200..428322(+) (phrC) [Bacillus subtilis subsp. subtilis strain ps4100]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=575313 KMZ16_RS02165 WP_003224994.1 428200..428322(+) (phrC) [Bacillus subtilis subsp. subtilis strain ps4100]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1