Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ZHX2020_RS13045 Genome accession   NZ_CP076409
Coordinates   2458038..2458160 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. ZHX3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 2453038..2463160
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ZHX2020_RS13030 (ZHX2020_12960) yclJ 2454652..2455335 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  ZHX2020_RS13035 (ZHX2020_12965) yclK 2455322..2456743 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  ZHX2020_RS13040 (ZHX2020_12970) rapC 2456906..2458054 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  ZHX2020_RS13045 (ZHX2020_12975) phrC 2458038..2458160 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ZHX2020_RS13050 (ZHX2020_12980) - 2458259..2458348 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  ZHX2020_RS13055 (ZHX2020_12985) - 2458430..2458543 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  ZHX2020_RS13060 (ZHX2020_12990) - 2458696..2460060 (-) 1365 WP_014478832.1 aspartate kinase -
  ZHX2020_RS13065 (ZHX2020_12995) ceuB 2460451..2461401 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  ZHX2020_RS13070 (ZHX2020_13000) yclO 2461394..2462341 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  ZHX2020_RS13075 (ZHX2020_13005) yclP 2462335..2463093 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=575149 ZHX2020_RS13045 WP_003224994.1 2458038..2458160(+) (phrC) [Bacillus sp. ZHX3]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=575149 ZHX2020_RS13045 WP_003224994.1 2458038..2458160(+) (phrC) [Bacillus sp. ZHX3]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1