Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KIL00_RS02160 Genome accession   NZ_CP075344
Coordinates   429886..430008 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis subsp. subtilis strain A1 - Midalam     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424886..435008
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KIL00_RS02145 (KIL00_02145) yclJ 426499..427182 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  KIL00_RS02150 (KIL00_02150) yclK 427169..428590 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  KIL00_RS02155 (KIL00_02155) rapC 428754..429902 (+) 1149 WP_069837255.1 response regulator aspartate phosphatase RapC Regulator
  KIL00_RS02160 (KIL00_02160) phrC 429886..430008 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KIL00_RS02165 (KIL00_02165) yczM 430107..430196 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KIL00_RS02170 (KIL00_02170) yczN 430278..430391 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  KIL00_RS02175 (KIL00_02175) thrD 430545..431909 (-) 1365 WP_021481755.1 aspartate kinase -
  KIL00_RS02180 (KIL00_02180) ceuB 432294..433244 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  KIL00_RS02185 (KIL00_02185) yclO 433237..434184 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  KIL00_RS02190 (KIL00_02190) yclP 434178..434936 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=568886 KIL00_RS02160 WP_003224994.1 429886..430008(+) (phrC) [Bacillus subtilis subsp. subtilis strain A1 - Midalam]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=568886 KIL00_RS02160 WP_003224994.1 429886..430008(+) (phrC) [Bacillus subtilis subsp. subtilis strain A1 - Midalam]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1