Detailed information    

insolico Bioinformatically predicted

Overview


Name   comS   Type   Regulator
Locus tag   - Genome accession   CP007565
Coordinates   215608..215661 (+) Length   18 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus agalactiae strain 138spar     
Function   activate transcription of comX; activate transcription of comS (predicted from homology)   
Competence regulation

Genomic Context


Location: 210608..220661
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  DN94_01220 - 211365..212165 (+) 801 AHX74407.1 hypothetical protein -
  DN94_01225 - 212253..212843 (+) 591 AHX74408.1 hypothetical protein -
  DN94_01230 - 213135..214433 (+) 1299 AHX74409.1 adenylosuccinate lyase -
  DN94_01235 comR 214586..215497 (+) 912 AHX74410.1 Cro/Cl family transcriptional regulator Regulator
  - comS 215608..215661 (+) 54 - - Regulator
  DN94_01240 ruvB 215794..216792 (+) 999 AHX74411.1 ATP-dependent DNA helicase RuvB Machinery gene
  DN94_01245 - 216944..217381 (+) 438 AHX74412.1 phosphotyrosine protein phosphatase -
  DN94_01250 - 217388..217768 (+) 381 AHX74413.1 membrane protein -
  DN94_01255 - 217765..219543 (+) 1779 AHX74414.1 acyltransferase -

Sequence


Protein


Download         Length: 18 a.a.        Molecular weight: 2032.32 Da        Isoelectric Point: 3.7498

>NTDB_id=567 215608..215661(+) (comS) [Streptococcus agalactiae strain 138spar]
SNLGSFDLFLGMGWWNMG

Nucleotide


Download         Length: 54 bp        

>NTDB_id=567 215608..215661(+) (comS) [Streptococcus agalactiae strain 138spar]
TCAAATTTAGGTTCATTTGATTTGTTTTTAGGAATGGGTTGGTGGAATATGGGC

XIP


This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

MGWWNMG


Domains



No domain identified.



Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value