Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KIH94_RS02125 Genome accession   NZ_CP074571
Coordinates   422117..422239 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BYS2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 417117..427239
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KIH94_RS02110 (KIH94_02110) yclJ 418730..419413 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  KIH94_RS02115 (KIH94_02115) yclK 419400..420821 (+) 1422 WP_080030630.1 two-component system sensor histidine kinase YclK -
  KIH94_RS02120 (KIH94_02120) rapC 420985..422133 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  KIH94_RS02125 (KIH94_02125) phrC 422117..422239 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KIH94_RS02130 (KIH94_02130) yczM 422339..422428 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KIH94_RS02135 (KIH94_02135) yczN 422510..422623 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  KIH94_RS02140 (KIH94_02140) thrD 422776..424140 (-) 1365 WP_015382767.1 aspartate kinase -
  KIH94_RS02145 (KIH94_02145) ceuB 424525..425475 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  KIH94_RS02150 (KIH94_02150) yclO 425468..426415 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  KIH94_RS02155 (KIH94_02155) yclP 426409..427167 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=565277 KIH94_RS02125 WP_003224994.1 422117..422239(+) (phrC) [Bacillus subtilis strain BYS2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=565277 KIH94_RS02125 WP_003224994.1 422117..422239(+) (phrC) [Bacillus subtilis strain BYS2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1