Detailed information
Bioinformatically predicted
Overview
| Name | comS | Type | Regulator |
| Locus tag | - | Genome accession | NC_021900 |
| Coordinates | 309280..309324 (+) | Length | 15 a.a. |
| NCBI ID | - | Uniprot ID | - |
| Organism | Streptococcus lutetiensis 033 | ||
| Function | activate transcription of comX; activate transcription of comS (predicted from homology) Competence regulation |
||
Genomic Context
Location: 304280..314324
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KE3_RS01630 (KE3_0331) | - | 304609..305058 (+) | 450 | WP_020916197.1 | DUF523 domain-containing protein | - |
| KE3_RS01635 (KE3_0332) | purE | 305058..305546 (+) | 489 | WP_020916198.1 | 5-(carboxyamino)imidazole ribonucleotide mutase | - |
| KE3_RS01640 (KE3_0333) | purK | 305533..306624 (+) | 1092 | WP_020916199.1 | 5-(carboxyamino)imidazole ribonucleotide synthase | - |
| KE3_RS11080 | - | 306627..306722 (+) | 96 | Protein_285 | phosphoribosylaminoimidazole carboxylase | - |
| KE3_RS01645 (KE3_0334) | purB | 306812..308110 (+) | 1299 | WP_020916200.1 | adenylosuccinate lyase | - |
| KE3_RS01650 (KE3_0335) | comR | 308299..309177 (+) | 879 | WP_173636488.1 | helix-turn-helix domain-containing protein | Regulator |
| - | comS | 309280..309324 (+) | 45 | - | - | Regulator |
| KE3_RS01655 (KE3_0337) | ruvB | 309379..310377 (+) | 999 | WP_020916203.1 | Holliday junction branch migration DNA helicase RuvB | - |
| KE3_RS10715 (KE3_0338) | - | 310550..310756 (+) | 207 | WP_020916204.1 | DUF7010 family protein | - |
| KE3_RS11180 (KE3_0339) | - | 310716..311081 (+) | 366 | WP_231853261.1 | DUF7010 family protein | - |
| KE3_RS01665 (KE3_0340) | - | 311320..311751 (+) | 432 | WP_014334179.1 | low molecular weight protein-tyrosine-phosphatase | - |
| KE3_RS01670 (KE3_0341) | - | 311769..312149 (+) | 381 | WP_006531314.1 | membrane protein | - |
| KE3_RS01675 (KE3_0342) | - | 312146..313939 (+) | 1794 | WP_020916207.1 | acyltransferase family protein | - |
Sequence
Protein
Download Length: 15 a.a. Molecular weight: 1736.15 Da Isoelectric Point: 9.1500
>NTDB_id=561 309280..309324(+) (comS) [Streptococcus lutetiensis 033]
MLKGFTVLLTAWWGL
MLKGFTVLLTAWWGL
Nucleotide
Download Length: 45 bp
>NTDB_id=561 309280..309324(+) (comS) [Streptococcus lutetiensis 033]
ATGTTAAAGGGATTTACGGTTTTATTGACAGCCTGGTGGGGATTG
ATGTTAAAGGGATTTACGGTTTTATTGACAGCCTGGTGGGGATTG
XIP
This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:
LTAWWGL
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comS | Streptococcus infantarius subsp. infantarius ATCC BAA-102 |
100 |
100 |
1 |