Detailed information    

insolico Bioinformatically predicted

Overview

Name   comS   Type   Regulator
Locus tag   - Genome accession   NZ_GL831112
Coordinates   1602179..1602241 (-) Length   21 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus vestibularis ATCC 49124     
Function   activate transcription of comX; activate transcription of comS (predicted from homology)   
Competence regulation

Genomic Context

Location: 1597179..1607241
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HMPREF9425_RS07715 (HMPREF9425_1614) - 1597302..1597817 (-) 516 WP_003097980.1 AmiS/UreI family transporter -
  HMPREF9425_RS10410 (HMPREF9425_1615) - 1598707..1599051 (+) 345 WP_227278548.1 urease cluster protein -
  HMPREF9425_RS10415 (HMPREF9425_1616) - 1599100..1599573 (+) 474 WP_244265345.1 DUF4153 domain-containing protein -
  HMPREF9425_RS07730 (HMPREF9425_1617) - 1599625..1599957 (-) 333 WP_003097990.1 DUF805 domain-containing protein -
  HMPREF9425_RS07735 - 1600068..1602163 (-) 2096 Protein_1574 peptide cleavage/export ABC transporter -
  - comS 1602179..1602241 (-) 63 - - Regulator
  HMPREF9425_RS07740 (HMPREF9425_1620) comR 1602330..1603229 (-) 900 WP_003098001.1 helix-turn-helix transcriptional regulator Regulator
  HMPREF9425_RS07745 (HMPREF9425_1621) - 1603385..1604035 (-) 651 WP_003092134.1 phosphatase PAP2 family protein -
  HMPREF9425_RS07750 (HMPREF9425_1622) - 1604038..1604595 (-) 558 WP_037621581.1 ECF transporter S component -
  HMPREF9425_RS07755 (HMPREF9425_1623) - 1604905..1605414 (-) 510 WP_003092259.1 tRNA (cytidine(34)-2'-O)-methyltransferase -
  HMPREF9425_RS07760 (HMPREF9425_1624) trkA 1605702..1607051 (+) 1350 WP_003098008.1 Trk system potassium transporter TrkA -

Sequence

Protein


Download         Length: 21 a.a.        Molecular weight: 2533.15 Da        Isoelectric Point: 8.5992

>NTDB_id=557 1602179..1602241(-) (comS) [Streptococcus vestibularis ATCC 49124]
ENLKKFLVLLIAAVPFFMIYY

Nucleotide


Download         Length: 63 bp        

>NTDB_id=557 1602179..1602241(-) (comS) [Streptococcus vestibularis ATCC 49124]
GAAAACTTAAAAAAATTTTTAGTCTTACTTATTGCGGCAGTACCATTCTTCATGATTTATTAT

XIP

This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

PFFMIYY


Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value