Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   J9312_RS02175 Genome accession   NZ_CP072845
Coordinates   429316..429438 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain XP     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 424316..434438
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  J9312_RS02160 (J9312_02150) yclJ 425930..426613 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  J9312_RS02165 (J9312_02155) yclK 426600..428021 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  J9312_RS02170 (J9312_02160) rapC 428184..429332 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  J9312_RS02175 (J9312_02165) phrC 429316..429438 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  J9312_RS02180 (J9312_02170) yczM 429537..429626 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  J9312_RS02185 (J9312_02175) yczN 429708..429821 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  J9312_RS02190 (J9312_02180) thrD 429974..431338 (-) 1365 WP_264379419.1 aspartate kinase -
  J9312_RS02195 (J9312_02185) ceuB 431723..432673 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  J9312_RS02200 (J9312_02190) yclO 432666..433613 (+) 948 WP_015252820.1 petrobactin ABC transporter permease YclO -
  J9312_RS02205 (J9312_02195) yclP 433607..434365 (+) 759 WP_015252819.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=556173 J9312_RS02175 WP_003224994.1 429316..429438(+) (phrC) [Bacillus subtilis strain XP]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=556173 J9312_RS02175 WP_003224994.1 429316..429438(+) (phrC) [Bacillus subtilis strain XP]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1