Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLF72_RS10555 Genome accession   NZ_CP068511
Coordinates   2074395..2074631 (-) Length   78 a.a.
NCBI ID   WP_014573335.1    Uniprot ID   -
Organism   Lactococcus cremoris strain F.2.7     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2069395..2079631
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLF72_RS10525 (LLF72_10320) - 2070589..2071398 (-) 810 WP_011677177.1 metal ABC transporter permease -
  LLF72_RS10530 (LLF72_10325) - 2071391..2072128 (-) 738 WP_015082929.1 metal ABC transporter ATP-binding protein -
  LLF72_RS10535 (LLF72_10330) - 2072307..2073149 (-) 843 WP_011677179.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  LLF72_RS10540 (LLF72_10335) - 2073146..2073583 (-) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  LLF72_RS10545 (LLF72_10340) comGG 2073663..2073962 (-) 300 WP_011677181.1 competence type IV pilus minor pilin ComGG Machinery gene
  LLF72_RS10550 (LLF72_10345) comGF 2073986..2074411 (-) 426 WP_373467301.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLF72_RS10555 (LLF72_10350) comGE 2074395..2074631 (-) 237 WP_014573335.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLF72_RS10560 (LLF72_13250) comGD 2074663..2074851 (-) 189 WP_014573336.1 hypothetical protein Machinery gene
  LLF72_RS10565 (LLF72_10360) comGC 2075053..2075403 (-) 351 WP_051013201.1 competence type IV pilus major pilin ComGC Machinery gene
  LLF72_RS10570 (LLF72_10365) comGB 2075448..2076473 (-) 1026 WP_051013189.1 competence type IV pilus assembly protein ComGB Machinery gene
  LLF72_RS10575 (LLF72_10370) comGA 2076373..2077353 (-) 981 WP_015082934.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence

Protein


Download         Length: 78 a.a.        Molecular weight: 8700.94 Da        Isoelectric Point: 4.3885

>NTDB_id=529203 LLF72_RS10555 WP_014573335.1 2074395..2074631(-) (comGE) [Lactococcus cremoris strain F.2.7]
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 237 bp        

>NTDB_id=529203 LLF72_RS10555 WP_014573335.1 2074395..2074631(-) (comGE) [Lactococcus cremoris strain F.2.7]
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(1-74)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

96.154

100

0.962