Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   K3G18_RS02160 Genome accession   NZ_CP080629
Coordinates   429497..429619 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain YPS-32     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 424497..434619
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  K3G18_RS02145 (K3G18_02145) yclJ 426111..426794 (+) 684 WP_032722955.1 two-component system response regulator YclJ -
  K3G18_RS02150 (K3G18_02150) yclK 426781..428202 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  K3G18_RS02155 (K3G18_02155) rapC 428365..429513 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  K3G18_RS02160 (K3G18_02160) phrC 429497..429619 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  K3G18_RS02165 (K3G18_02165) yczM 429719..429808 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  K3G18_RS02170 (K3G18_02170) yczN 429890..430003 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  K3G18_RS02175 (K3G18_02175) thrD 430156..431520 (-) 1365 WP_015715246.1 aspartate kinase -
  K3G18_RS02180 (K3G18_02180) ceuB 431905..432855 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  K3G18_RS02185 (K3G18_02185) yclO 432848..433795 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  K3G18_RS02190 (K3G18_02190) yclP 433789..434547 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=521205 K3G18_RS02160 WP_003224994.1 429497..429619(+) (phrC) [Bacillus subtilis strain YPS-32]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=521205 K3G18_RS02160 WP_003224994.1 429497..429619(+) (phrC) [Bacillus subtilis strain YPS-32]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1