Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   JEQ25_RS02155 Genome accession   NZ_CP066380
Coordinates   422323..422445 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ID-A05     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 417323..427445
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  JEQ25_RS02140 (JEQ25_02125) yclJ 418936..419619 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  JEQ25_RS02145 (JEQ25_02130) yclK 419606..421027 (+) 1422 WP_082098066.1 two-component system sensor histidine kinase YclK -
  JEQ25_RS02150 (JEQ25_02135) rapC 421191..422339 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  JEQ25_RS02155 (JEQ25_02140) phrC 422323..422445 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  JEQ25_RS02160 (JEQ25_02145) yczM 422545..422634 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  JEQ25_RS02165 (JEQ25_02150) yczN 422716..422829 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  JEQ25_RS02170 (JEQ25_02155) thrD 422983..424347 (-) 1365 WP_038428355.1 aspartate kinase -
  JEQ25_RS02175 (JEQ25_02160) ceuB 424732..425682 (+) 951 WP_038428356.1 petrobactin ABC transporter permease YclN Machinery gene
  JEQ25_RS02180 (JEQ25_02165) yclO 425675..426622 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  JEQ25_RS02185 (JEQ25_02170) yclP 426616..427374 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=519791 JEQ25_RS02155 WP_003224994.1 422323..422445(+) (phrC) [Bacillus subtilis strain ID-A05]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=519791 JEQ25_RS02155 WP_003224994.1 422323..422445(+) (phrC) [Bacillus subtilis strain ID-A05]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1