Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLDRC3_RS11385 Genome accession   NZ_CP064835
Coordinates   2214433..2214729 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   A0A3N6L9Y1
Organism   Lactococcus lactis subsp. lactis strain DRC3     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2209433..2219729
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLDRC3_RS11350 (LLDRC3_2177) - 2209723..2210589 (+) 867 WP_010906309.1 RluA family pseudouridine synthase -
  LLDRC3_RS11355 (LLDRC3_2178) - 2210628..2211437 (-) 810 WP_010906310.1 metal ABC transporter permease -
  LLDRC3_RS11360 (LLDRC3_2179) - 2211430..2212167 (-) 738 WP_010906311.1 metal ABC transporter ATP-binding protein -
  LLDRC3_RS11365 (LLDRC3_2180) - 2212344..2213186 (-) 843 WP_063283655.1 metal ABC transporter substrate-binding protein -
  LLDRC3_RS11370 (LLDRC3_2181) - 2213183..2213620 (-) 438 WP_010906313.1 zinc-dependent MarR family transcriptional regulator -
  LLDRC3_RS11375 (LLDRC3_2182) comGG 2213701..2213985 (-) 285 WP_010906314.1 competence type IV pilus minor pilin ComGG Machinery gene
  LLDRC3_RS11380 (LLDRC3_2183) comGF 2214024..2214470 (-) 447 WP_031296844.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLDRC3_RS11385 (LLDRC3_2184) comGE 2214433..2214729 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLDRC3_RS11390 (LLDRC3_2185) comGD 2214701..2215099 (-) 399 WP_021214886.1 competence type IV pilus minor pilin ComGD Machinery gene
  LLDRC3_RS11395 (LLDRC3_2186) comGC 2215092..2215475 (-) 384 WP_010906318.1 competence type IV pilus major pilin ComGC Machinery gene
  LLDRC3_RS11400 (LLDRC3_2187) comGB 2215489..2216562 (-) 1074 WP_010906319.1 competence type IV pilus assembly protein ComGB Machinery gene
  LLDRC3_RS11405 (LLDRC3_2188) comGA 2216456..2217394 (-) 939 WP_031561106.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=505116 LLDRC3_RS11385 WP_010906316.1 2214433..2214729(-) (comGE) [Lactococcus lactis subsp. lactis strain DRC3]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=505116 LLDRC3_RS11385 WP_010906316.1 2214433..2214729(-) (comGE) [Lactococcus lactis subsp. lactis strain DRC3]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A3N6L9Y1

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673