Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   IE382_RS03580 Genome accession   NZ_CP061870
Coordinates   695603..695725 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain FX-1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 690603..700725
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  IE382_RS03565 (IE382_03535) yclJ 692216..692899 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  IE382_RS03570 (IE382_03540) yclK 692886..694307 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  IE382_RS03575 (IE382_03545) rapC 694471..695619 (+) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  IE382_RS03580 (IE382_03550) phrC 695603..695725 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  IE382_RS03585 (IE382_03555) yczM 695825..695914 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  IE382_RS03590 (IE382_03560) yczN 695996..696109 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  IE382_RS03595 (IE382_03565) thrD 696263..697627 (-) 1365 WP_033883679.1 aspartate kinase -
  IE382_RS03600 (IE382_03570) ceuB 698012..698962 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  IE382_RS03605 (IE382_03575) yclO 698955..699902 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  IE382_RS03610 (IE382_03580) yclP 699896..700654 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=485413 IE382_RS03580 WP_003224994.1 695603..695725(+) (phrC) [Bacillus subtilis strain FX-1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=485413 IE382_RS03580 WP_003224994.1 695603..695725(+) (phrC) [Bacillus subtilis strain FX-1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1