Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   J7W01_RS02115 Genome accession   NZ_CP072525
Coordinates   421492..421614 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain YB-04     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416492..426614
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  J7W01_RS02100 (J7W01_02100) yclJ 418105..418788 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  J7W01_RS02105 (J7W01_02105) yclK 418775..420196 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  J7W01_RS02110 (J7W01_02110) rapC 420360..421508 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  J7W01_RS02115 (J7W01_02115) phrC 421492..421614 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  J7W01_RS02120 (J7W01_02120) yczM 421716..421805 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  J7W01_RS02125 (J7W01_02125) yczN 421887..422000 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  J7W01_RS02130 (J7W01_02130) thrD 422154..423518 (-) 1365 WP_043940054.1 aspartate kinase -
  J7W01_RS02135 (J7W01_02135) ceuB 423903..424853 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  J7W01_RS02140 (J7W01_02140) yclO 424846..425793 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  J7W01_RS02145 (J7W01_02145) yclP 425787..426545 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=483769 J7W01_RS02115 WP_003224994.1 421492..421614(+) (phrC) [Bacillus subtilis strain YB-04]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=483769 J7W01_RS02115 WP_003224994.1 421492..421614(+) (phrC) [Bacillus subtilis strain YB-04]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1