Detailed information
Bioinformatically predicted
Overview
| Name | HI0659 | Type | Machinery gene |
| Locus tag | H9Q79_RS14310 | Genome accession | NZ_CP060635 |
| Coordinates | 3097008..3097307 (-) | Length | 99 a.a. |
| NCBI ID | WP_118647197.1 | Uniprot ID | A0A7G9GB65 |
| Organism | Wansuia hejianensis strain NSJ-29 | ||
| Function | DNA uptake (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Prophage | 3071520..3121859 | 3097008..3097307 | within | 0 |
Gene organization within MGE regions
Location: 3071520..3121859
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| H9Q79_RS14150 (H9Q79_14135) | - | 3071544..3072476 (+) | 933 | WP_249329730.1 | MoxR family ATPase | - |
| H9Q79_RS14155 (H9Q79_14140) | - | 3072481..3073557 (+) | 1077 | WP_249328568.1 | DUF58 domain-containing protein | - |
| H9Q79_RS14160 (H9Q79_14145) | - | 3073524..3075959 (+) | 2436 | WP_249328569.1 | transglutaminase family protein | - |
| H9Q79_RS14165 (H9Q79_14150) | - | 3076099..3077247 (-) | 1149 | WP_249328570.1 | integrase | - |
| H9Q79_RS14170 (H9Q79_14155) | dinD | 3077404..3078258 (-) | 855 | WP_118648023.1 | DNA damage-inducible protein D | - |
| H9Q79_RS18680 | - | 3078477..3078566 (-) | 90 | WP_408646438.1 | putative holin-like toxin | - |
| H9Q79_RS14175 (H9Q79_14160) | - | 3078692..3079123 (-) | 432 | WP_249328571.1 | hypothetical protein | - |
| H9Q79_RS14180 (H9Q79_14165) | - | 3079107..3079487 (-) | 381 | WP_249328572.1 | helix-turn-helix domain-containing protein | - |
| H9Q79_RS14185 (H9Q79_14170) | - | 3079708..3079905 (+) | 198 | WP_249328573.1 | helix-turn-helix transcriptional regulator | - |
| H9Q79_RS14190 (H9Q79_14175) | - | 3079907..3080125 (+) | 219 | WP_249328574.1 | hypothetical protein | - |
| H9Q79_RS14195 (H9Q79_14180) | - | 3080129..3080368 (+) | 240 | WP_118647244.1 | hypothetical protein | - |
| H9Q79_RS14200 (H9Q79_14185) | - | 3080365..3080547 (+) | 183 | WP_118647242.1 | hypothetical protein | - |
| H9Q79_RS14205 (H9Q79_14190) | - | 3080734..3080910 (+) | 177 | WP_249328575.1 | hypothetical protein | - |
| H9Q79_RS14210 (H9Q79_14195) | - | 3080907..3081473 (+) | 567 | WP_118647240.1 | ERF family protein | - |
| H9Q79_RS14215 (H9Q79_14200) | - | 3081658..3082542 (+) | 885 | WP_249328576.1 | hypothetical protein | - |
| H9Q79_RS14220 (H9Q79_14210) | - | 3082842..3083024 (+) | 183 | WP_118647236.1 | hypothetical protein | - |
| H9Q79_RS14225 (H9Q79_14215) | - | 3083160..3083510 (+) | 351 | WP_147371492.1 | hypothetical protein | - |
| H9Q79_RS14230 (H9Q79_14220) | - | 3083673..3084011 (+) | 339 | WP_147371491.1 | hypothetical protein | - |
| H9Q79_RS14235 (H9Q79_14225) | - | 3084116..3084277 (+) | 162 | WP_249328577.1 | hypothetical protein | - |
| H9Q79_RS14240 (H9Q79_14230) | - | 3084274..3084591 (+) | 318 | WP_249328578.1 | hypothetical protein | - |
| H9Q79_RS14245 (H9Q79_14235) | - | 3084615..3084824 (+) | 210 | WP_118647227.1 | hypothetical protein | - |
| H9Q79_RS14250 (H9Q79_14240) | - | 3085422..3085949 (+) | 528 | WP_118647223.1 | terminase small subunit | - |
| H9Q79_RS14255 (H9Q79_14245) | - | 3085946..3087478 (+) | 1533 | WP_249328579.1 | phage terminase large subunit | - |
| H9Q79_RS18685 (H9Q79_14250) | - | 3087469..3087978 (+) | 510 | WP_408646439.1 | HNH endonuclease signature motif containing protein | - |
| H9Q79_RS14260 (H9Q79_14255) | - | 3087959..3088207 (+) | 249 | WP_118647217.1 | hypothetical protein | - |
| H9Q79_RS14265 (H9Q79_14260) | - | 3088204..3090318 (+) | 2115 | WP_118647215.1 | hypothetical protein | - |
| H9Q79_RS14270 (H9Q79_14265) | - | 3090315..3090626 (+) | 312 | WP_249328580.1 | ribosomal-processing cysteine protease Prp | - |
| H9Q79_RS14275 (H9Q79_14270) | - | 3090793..3091662 (+) | 870 | WP_147371490.1 | hypothetical protein | - |
| H9Q79_RS14280 (H9Q79_14275) | - | 3091686..3092714 (+) | 1029 | WP_118647209.1 | N4-gp56 family major capsid protein | - |
| H9Q79_RS14285 (H9Q79_14280) | - | 3092747..3092992 (+) | 246 | WP_118647207.1 | hypothetical protein | - |
| H9Q79_RS14290 (H9Q79_14285) | - | 3093088..3093516 (+) | 429 | WP_118647205.1 | hypothetical protein | - |
| H9Q79_RS14295 (H9Q79_14290) | - | 3093531..3095345 (+) | 1815 | WP_249328581.1 | hypothetical protein | - |
| H9Q79_RS14300 (H9Q79_14295) | - | 3095342..3096280 (+) | 939 | WP_249328582.1 | hypothetical protein | - |
| H9Q79_RS14305 (H9Q79_14300) | - | 3096354..3096737 (-) | 384 | WP_249328583.1 | hypothetical protein | - |
| H9Q79_RS14310 (H9Q79_14305) | HI0659 | 3097008..3097307 (-) | 300 | WP_118647197.1 | helix-turn-helix domain-containing protein | Machinery gene |
| H9Q79_RS14315 (H9Q79_14310) | - | 3097300..3097662 (-) | 363 | WP_118647195.1 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| H9Q79_RS14320 (H9Q79_14315) | - | 3097830..3099245 (+) | 1416 | WP_249328584.1 | hypothetical protein | - |
| H9Q79_RS14325 (H9Q79_14320) | - | 3099257..3110188 (+) | 10932 | WP_249328585.1 | hypothetical protein | - |
| H9Q79_RS14330 (H9Q79_14325) | - | 3110306..3110890 (+) | 585 | WP_118647181.1 | BppU family phage baseplate upper protein | - |
| H9Q79_RS14335 (H9Q79_14330) | - | 3110902..3113085 (+) | 2184 | WP_249328586.1 | hypothetical protein | - |
| H9Q79_RS14340 (H9Q79_14335) | - | 3113154..3113855 (+) | 702 | WP_249328587.1 | BppU family phage baseplate upper protein | - |
| H9Q79_RS14345 (H9Q79_14340) | - | 3113874..3114524 (+) | 651 | WP_147371489.1 | collagen-like protein | - |
| H9Q79_RS14350 (H9Q79_14345) | - | 3114535..3115017 (+) | 483 | WP_118647173.1 | holin family protein | - |
| H9Q79_RS14355 (H9Q79_14350) | - | 3115031..3116026 (+) | 996 | WP_118647171.1 | peptidoglycan-binding protein | - |
| H9Q79_RS14360 (H9Q79_14355) | - | 3116064..3116390 (-) | 327 | WP_118647169.1 | sporulation initiation factor Spo0A C-terminal domain-containing protein | - |
| H9Q79_RS14365 (H9Q79_14360) | - | 3116568..3116966 (-) | 399 | WP_118647167.1 | type II toxin-antitoxin system HicB family antitoxin | - |
| H9Q79_RS18550 (H9Q79_14365) | - | 3117011..3117196 (-) | 186 | WP_118647165.1 | type II toxin-antitoxin system HicA family toxin | - |
| H9Q79_RS14375 (H9Q79_14370) | - | 3117462..3118331 (+) | 870 | WP_249328588.1 | SpoIID/LytB domain-containing protein | - |
| H9Q79_RS14380 (H9Q79_14375) | - | 3118423..3118608 (+) | 186 | WP_249328589.1 | hypothetical protein | - |
| H9Q79_RS14385 (H9Q79_14380) | - | 3118713..3119495 (+) | 783 | WP_249328590.1 | M23 family metallopeptidase | - |
| H9Q79_RS14390 (H9Q79_14385) | - | 3120405..3121859 (+) | 1455 | WP_249328591.1 | DEAD/DEAH box helicase | - |
Sequence
Protein
Download Length: 99 a.a. Molecular weight: 11008.75 Da Isoelectric Point: 6.3863
>NTDB_id=476886 H9Q79_RS14310 WP_118647197.1 3097008..3097307(-) (HI0659) [Wansuia hejianensis strain NSJ-29]
MSNTNNSAIGRSWEEVERELFTPEEIAESNLRVALIGELIKARQEKGISQKRLEEMSGVKQPIIARMEKGNTNPQLETVL
KILAPLGKTLAIVPLDPTK
MSNTNNSAIGRSWEEVERELFTPEEIAESNLRVALIGELIKARQEKGISQKRLEEMSGVKQPIIARMEKGNTNPQLETVL
KILAPLGKTLAIVPLDPTK
Nucleotide
Download Length: 300 bp
>NTDB_id=476886 H9Q79_RS14310 WP_118647197.1 3097008..3097307(-) (HI0659) [Wansuia hejianensis strain NSJ-29]
ATGAGTAACACAAATAATTCTGCTATCGGCAGAAGCTGGGAAGAAGTAGAAAGAGAGCTTTTCACCCCAGAAGAAATAGC
GGAGAGCAATTTAAGAGTAGCTCTTATTGGAGAGCTTATTAAGGCAAGACAGGAAAAGGGCATAAGCCAAAAAAGGCTTG
AAGAAATGAGCGGAGTAAAACAGCCAATCATAGCCAGAATGGAAAAAGGGAACACGAATCCACAGCTTGAGACCGTCTTA
AAGATTTTAGCTCCACTGGGAAAAACTCTTGCCATTGTTCCGCTTGATCCTACCAAATAA
ATGAGTAACACAAATAATTCTGCTATCGGCAGAAGCTGGGAAGAAGTAGAAAGAGAGCTTTTCACCCCAGAAGAAATAGC
GGAGAGCAATTTAAGAGTAGCTCTTATTGGAGAGCTTATTAAGGCAAGACAGGAAAAGGGCATAAGCCAAAAAAGGCTTG
AAGAAATGAGCGGAGTAAAACAGCCAATCATAGCCAGAATGGAAAAAGGGAACACGAATCCACAGCTTGAGACCGTCTTA
AAGATTTTAGCTCCACTGGGAAAAACTCTTGCCATTGTTCCGCTTGATCCTACCAAATAA
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| HI0659 | Haemophilus influenzae Rd KW20 |
70.787 |
89.899 |
0.636 |