Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLUL021_RS11505 Genome accession   NZ_CP070263
Coordinates   2263908..2264204 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   Q9CDU2
Organism   Lactococcus lactis subsp. lactis strain UL021     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2258908..2269204
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLUL021_RS11475 (LLUL021_11435) - 2260094..2260903 (-) 810 WP_014570791.1 metal ABC transporter permease -
  LLUL021_RS11480 (LLUL021_11440) - 2260896..2261633 (-) 738 WP_058221575.1 metal ABC transporter ATP-binding protein -
  LLUL021_RS11485 (LLUL021_11445) - 2261810..2262652 (-) 843 WP_003129990.1 metal ABC transporter substrate-binding protein -
  LLUL021_RS11490 (LLUL021_11450) - 2262649..2263086 (-) 438 WP_003129992.1 zinc-dependent MarR family transcriptional regulator -
  LLUL021_RS11495 (LLUL021_11455) comGG 2263176..2263460 (-) 285 WP_003129993.1 competence type IV pilus minor pilin ComGG Machinery gene
  LLUL021_RS11500 (LLUL021_11460) comGF 2263499..2263945 (-) 447 WP_029344525.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLUL021_RS11505 (LLUL021_11465) comGE 2263908..2264204 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLUL021_RS11510 (LLUL021_11470) comGD 2264176..2264607 (-) 432 WP_080585155.1 competence type IV pilus minor pilin ComGD Machinery gene
  LLUL021_RS11515 (LLUL021_11475) comGC 2264567..2264863 (-) 297 WP_212715809.1 competence type IV pilus major pilin ComGC Machinery gene
  LLUL021_RS11520 (LLUL021_11480) - 2265025..2265804 (-) 780 WP_137016631.1 peptidoglycan amidohydrolase family protein -
  LLUL021_RS11525 (LLUL021_11485) - 2265804..2266091 (-) 288 WP_137016629.1 phage holin -
  LLUL021_RS11530 (LLUL021_11490) - 2266104..2266454 (-) 351 WP_014570798.1 hypothetical protein -
  LLUL021_RS11535 (LLUL021_11495) - 2266467..2266703 (-) 237 WP_137016624.1 hypothetical protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=473841 LLUL021_RS11505 WP_010906316.1 2263908..2264204(-) (comGE) [Lactococcus lactis subsp. lactis strain UL021]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=473841 LLUL021_RS11505 WP_010906316.1 2263908..2264204(-) (comGE) [Lactococcus lactis subsp. lactis strain UL021]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q9CDU2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673