Detailed information    

experimental Experimentally validated

Overview

Name   comS   Type   Regulator
Locus tag   - Genome accession   NC_017620
Coordinates   60555..60623 (+) Length   23 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus suis D9     
Function   activate transcription of comX   
Competence regulation

Function

Induction of competence was dependent on ComX, a sigma factor that controls the streptococcal late competence regulon, extracellular addition of a comX-inducing peptide (XIP), and ComR, a regulator of comX. XIP was identified as an N-terminally truncated variant of ComS.


Genomic Context

Location: 55555..65623
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  SSUD9_RS11460 (SSUD9_0052) - 56464..56637 (+) 174 WP_014636741.1 hypothetical protein -
  SSUD9_RS00340 (SSUD9_0053) ruvB 56932..57933 (+) 1002 WP_002935300.1 Holliday junction branch migration DNA helicase RuvB Machinery gene
  SSUD9_RS00345 (SSUD9_0054) - 57933..58679 (+) 747 WP_002935299.1 GNAT family N-acetyltransferase -
  SSUD9_RS00350 (SSUD9_0055) - 58681..59319 (+) 639 WP_002935298.1 HAD-IA family hydrolase -
  SSUD9_RS00355 (SSUD9_0056) comR 59566..60483 (+) 918 WP_002935296.1 helix-turn-helix domain-containing protein Regulator
  - comS 60555..60623 (+) 69 - - Regulator
  SSUD9_RS00360 (SSUD9_0058) - 60892..62094 (-) 1203 WP_002935295.1 IS110-like element ISSsu7 family transposase -
  SSUD9_RS00365 (SSUD9_0059) - 62371..63612 (+) 1242 WP_013730059.1 bifunctional folylpolyglutamate synthase/dihydrofolate synthase -
  SSUD9_RS00375 (SSUD9_0061) - 63781..65304 (+) 1524 WP_004194221.1 Heme/copper-type cytochrome/quinol oxidase subunit 1 -

Regulatory network

Positive effect      
Negative effect
Regulator Target Regulation
  comS comX/sigX positive effect
  comX/sigX late competence genes positive effect
  comX/sigX late competence genes positive effect
  comR comX/sigX positive effect

Sequence

Protein


Download         Length: 23 a.a.        Molecular weight: 2716.11 Da        Isoelectric Point: 5.9481

>NTDB_id=459 60555..60623(+) (comS) [Streptococcus suis D9]
MFQFFKFFGGFGQLGDENWWVK*

Nucleotide


Download         Length: 69 bp        

>NTDB_id=459 60555..60623(+) (comS) [Streptococcus suis D9]
ATGTTTCAATTTTTTAAATTTTTTGGTGGTTTTGGTCAACTTGGTGATGAGAACTGGTGGGTAAAATAA

XIP

This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

DENWWVK


Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value

References

[1] Edoardo Zaccaria et al. (2014) Control of competence for DNA transformation in streptococcus suis by genetically transferable pherotypes. PloS One 9(6):e99394. [PMID: 24968201]